-
PurposeAn AAV vector that expresses engineered halorhodopsin 3.0 (fused to iRFP) in a Cre-dependent manner (DIO, double floxed inverted open reading frame).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47631 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV EF1a DIO
-
Backbone manufacturerKarl Deisseroth
- Backbone size w/o insert (bp) 5637
-
Modifications to backboneinserted a C between lox2722 and NheI restriction site to disrupt a synthetic start codon in the 5'UTR.
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeNpHR3.0
-
GenBank IDEF474018
- Promoter EF1a
-
Tag
/ Fusion Protein
- iRFP (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer EF1a_F1 (5'-CAAGCCTCAGACAGTGGTTC)
- 3′ sequencing primer WPRE_R1 (5'ATGAAAGCCATACGGGAAGC) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythe ORF for iRFP was obtained from Addgene (Plasmid 31857). the ORF for eNpHR3.0 was obtained from Karl Deisseroth, but is also available from Addgene (Plasmid 26971). the backbone was obtained from Karl Deisseroth, but is also available from Addgene (Plasmid 35507).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC469 - pAAV EF1a DIO eNpHR3.0-iRFP was a gift from Brandon Harvey (Addgene plasmid # 47631 ; http://n2t.net/addgene:47631 ; RRID:Addgene_47631) -
For your References section:
Near-infrared fluorescent protein iRFP713 as a reporter protein for optogenetic vectors, a transgenic Cre-reporter rat, and other neuronal studies. Richie CT, Whitaker LR, Whitaker KW, Necarsulmer J, Baldwin HA, Zhang Y, Fortuno L, Hinkle JJ, Koivula P, Henderson MJ, Sun W, Wang K, Smith JC, Pickel J, Ji N, Hope BT, Harvey BK. J Neurosci Methods. 2017 Jun 1;284:1-14. doi: 10.1016/j.jneumeth.2017.03.020. Epub 2017 Apr 2. 10.1016/j.jneumeth.2017.03.020 PubMed 28380331