pMiR-E6AP-3'UTR
(Plasmid
#53694)
-
PurposeLuciferase reporter assay for microRNA binding on E6AP 3'UTR
-
Depositing Lab
-
Depositing OrganizationUniversity of Florida
Located in the United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53694 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 53694-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 53694-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMiR-Target
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 7900
- Total vector size (bp) 9800
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUBE3A 3'UTR
-
Alt nameE6AP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1896
-
GenBank IDNM_000462.3
-
Entrez GeneUBE3A (a.k.a. ANCR, AS, E6-AP, EPVE6AP, HPVE6A, PIX1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
- 3′ sequencing primer CTGGAGGATCATCCAGCCGGCGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 53694-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 53694-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMiR-E6AP-3'UTR was a gift from Edward Chan (Addgene plasmid # 53694 ; http://n2t.net/addgene:53694 ; RRID:Addgene_53694) -
For your References section:
miR-375 activates p21 and suppresses telomerase activity by coordinately regulating HPV E6/E7, E6AP, CIP2A, and 14-3-3zeta. Jung HM, Phillips BL, Chan EK. Mol Cancer. 2014 Apr 8;13(1):80. doi: 10.1186/1476-4598-13-80. 10.1186/1476-4598-13-80 PubMed 24708873
Map uploaded by the depositor.