CMV ArcLightCo (Q239)-T2A-nls-mCherry
(Plasmid #85806)

• Purpose: Genetically encoded voltage sensor ArcLight- codon optimized
• Depositing Lab: Vincent Pieribone
• Depositing Organization: John B. Pierce Laboratory
  Located in United States of America
• Publication: Platisa et al ACS Chem Neurosci. 2017 Jan 3. doi: 10.1021/acschemneuro.6b00234.

Backbone

• Vector backbone: pCS2+ CMV
• Backbone size w/o insert (bp): 4903
• Total vector size (bp): 6364
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ArcLightCo-Q239
• Alt name: ArcLight codon optimized
• Alt name: CiVSP
• Alt name: Super Ecliptic pHluorin
• Species: Ciona intestinalis
• Insert Size (bp): 1461
• Mutation: Ci-VSP contains R217Q mutation; super ecliptic pHluorin contains A227D mutation. The A227D mutation increases the fluorescence response magnitude. We replaced residues 71-91 within CiVSD with an amino acid sequence (KSRITSEGEYIPLDQIDINV) from the Kir2.1 channel Golgi-to-plasma membrane trafficking signal. The Kir 2.1 channel ER export signal sequence (FCYENEV) was added to C-terminus of super ecliptic pHluorin. The sequence is codon optimized using mammalian codon preference.
• GenBank ID: AB183035 AY533296
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: SphI (not destroyed)
• 5′ sequencing primer: gttcaatactatgtattggccctatgc
• 3′ sequencing primer: ccttgagcatctgacttctggcta

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Dr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A portion of this plasmid was derived from a plasmid made by Dr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.

DNA (Catalog # 85806-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 85806-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.