-
PurposeFluorescent reporter for voltage imaging
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83960 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1/Puro-CAG
-
Backbone manufacturerInvitrogen/Dr. Paulmurugan Ramasamy
- Backbone size w/o insert (bp) 6108
- Total vector size (bp) 7386
-
Modifications to backboneIn pcDNA3.1/Puro-CAG, the cytomegalovirus enhancer and chicken beta-actin promoter replace the cytomegalovirus enhancer-promoter of pcDNA3.1-Puro.
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameASAP2f
-
SpeciesSynthetic
-
Insert Size (bp)1278
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
- 3′ sequencing primer BGH Reverse (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ASAP2f was a gift from Michael Lin (Addgene plasmid # 83960 ; http://n2t.net/addgene:83960 ; RRID:Addgene_83960) -
For your References section:
Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo. Yang HH, St-Pierre F, Sun X, Ding X, Lin MZ, Clandinin TR. Cell. 2016 Jun 30;166(1):245-57. doi: 10.1016/j.cell.2016.05.031. Epub 2016 Jun 2. 10.1016/j.cell.2016.05.031 PubMed 27264607