pcDNA3.1/Puro-CAG-ASAP2s
(Plasmid #101274)

• Purpose: Genetically encoded voltage indicator ASAP2s expressed under strong mammalian promoter (CAG)
• Depositing Lab: Francois St-Pierre
• Publication: Chamberland et al Elife. 2017 Jul 27;6. pii: e25690. doi: 10.7554/eLife.25690.

Backbone

• Vector backbone: pcDNA3.1/Puro-CAG
• Backbone manufacturer: Invitrogen/Dr. Paulmurugan Ramasamy
• Backbone size w/o insert (bp): 6107
• Total vector size (bp): 7389
• Modifications to backbone: In pcDNA3.1/Puro-CAG, the cytomegalovirus enhancer and chicken beta-actin promoter replace the cytomegalovirus enhancer-promoter of pcDNA3.1-Puro.
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ASAP2s
• Species: Synthetic
• Insert Size (bp): 1281
• GenBank ID: MF682491
• Promoter: CAG

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AAGGTGGTGGCTGGTGTGGC
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pc3-puro-CAG-ASAP2s.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The next-generation JEDI-2P sensors are available at: https://www.addgene.org/browse/article/28223314/