-
PurposeFor mammalian expression of the fluorescent voltage sensor ASAP1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52519 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1/Puro-CAG
-
Backbone manufacturerInvitrogen/Dr. Paulmurugan Ramasamy
- Backbone size w/o insert (bp) 6107
- Total vector size (bp) 7389
-
Modifications to backboneIn pcDNA3.1/Puro-CAG, the cytomegalovirus enhancer and chicken beta-actin promoter replace the cytomegalovirus enhancer-promoter of pcDNA3.1-Puro.
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAccelerated Sensor of Action Potentials 1
-
Alt nameASAP1
-
SpeciesSynthetic; Aequorea victoria
-
Insert Size (bp)1281
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
- 3′ sequencing primer BGH Reverse
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1/Puro-CAG-ASAP1 was a gift from Michael Lin (Addgene plasmid # 52519 ; http://n2t.net/addgene:52519 ; RRID:Addgene_52519) -
For your References section:
High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor. St-Pierre F, Marshall JD, Yang Y, Gong Y, Schnitzer MJ, Lin MZ. Nat Neurosci. 2014 Apr 22. doi: 10.1038/nn.3709. 10.1038/nn.3709 PubMed 24755780