This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3.1/Puro-CAG-ASAP1
(Plasmid #52519)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52519 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1/Puro-CAG
  • Backbone manufacturer
    Invitrogen/Dr. Paulmurugan Ramasamy
  • Backbone size w/o insert (bp) 6107
  • Total vector size (bp) 7389
  • Modifications to backbone
    In pcDNA3.1/Puro-CAG, the cytomegalovirus enhancer and chicken beta-actin promoter replace the cytomegalovirus enhancer-promoter of pcDNA3.1-Puro.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Accelerated Sensor of Action Potentials 1
  • Alt name
    ASAP1
  • Species
    Synthetic; Aequorea victoria
  • Insert Size (bp)
    1281
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
  • 3′ sequencing primer BGH Reverse
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1/Puro-CAG-ASAP1 was a gift from Michael Lin (Addgene plasmid # 52519)
  • For your References section:

    High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor. St-Pierre F, Marshall JD, Yang Y, Gong Y, Schnitzer MJ, Lin MZ. Nat Neurosci. 2014 Apr 22. doi: 10.1038/nn.3709. 10.1038/nn.3709 PubMed 24755780