Skip to main content

pcDNA3.1/Puro-CAG-ASAP1
(Plasmid #52519)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52519 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 52519-D50 50 μg of DNA in Tris buffer $495
DNA 52519-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1/Puro-CAG
  • Backbone manufacturer
    Invitrogen/Dr. Paulmurugan Ramasamy
  • Backbone size w/o insert (bp) 6107
  • Total vector size (bp) 7389
  • Modifications to backbone
    In pcDNA3.1/Puro-CAG, the cytomegalovirus enhancer and chicken beta-actin promoter replace the cytomegalovirus enhancer-promoter of pcDNA3.1-Puro.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Accelerated Sensor of Action Potentials 1
  • Alt name
    ASAP1
  • Species
    Synthetic; Aequorea victoria
  • Insert Size (bp)
    1281
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
  • 3′ sequencing primer BGH Reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1/Puro-CAG-ASAP1 was a gift from Michael Lin (Addgene plasmid # 52519 ; http://n2t.net/addgene:52519 ; RRID:Addgene_52519)
  • For your References section:

    High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor. St-Pierre F, Marshall JD, Yang Y, Gong Y, Schnitzer MJ, Lin MZ. Nat Neurosci. 2014 Apr 22. doi: 10.1038/nn.3709. 10.1038/nn.3709 PubMed 24755780