-
PurposeCoexpression plasmid of QuasAr2 and CheRiff for all-optical electrophysiology
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 51694 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFCK(1.3)
-
Backbone manufacturerPavel Osten
- Backbone size w/o insert (bp) 9236
- Total vector size (bp) 12590
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recombinase-free E. coli (e.g., Invitrogen's Stbl3)
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameOptopatch2
-
SpeciesSynthetic
-
Insert Size (bp)3354
- Promoter CaMKIIa
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DRH296: FCK-Optopatch2 was a gift from Adam Cohen (Addgene plasmid # 51694 ; http://n2t.net/addgene:51694 ; RRID:Addgene_51694) -
For your References section:
All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins. Hochbaum DR, Zhao Y, Farhi SL, Klapoetke N, Werley CA, Kapoor V, Zou P, Kralj JM, Maclaurin D, Smedemark-Margulies N, Saulnier JL, Boulting GL, Straub C, Cho YK, Melkonian M, Wong GK, Harrison DJ, Murthy VN, Sabatini BL, Boyden ES, Campbell RE, Cohen AE. Nat Methods. 2014 Aug;11(8):825-33. doi: 10.1038/nmeth.3000. Epub 2014 Jun 22. 10.1038/nmeth.3000 PubMed 24952910