-
Purposegenetically-encoded fluorescent voltage indicator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 74216 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 4900
- Total vector size (bp) 6361
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefluorescent protein voltage sensor
-
Alt nameGEVI Marina
-
SpeciesCiona intestinalis
-
Insert Size (bp)1461
-
MutationCi-VSP contains R217Q mutation; super ecliptic pHluorin contains D147A, H148A, Y200V and A227D mutations. These mutations cause depolarization-dependent increase in fluorescence intensity. We replaced residues 71-91 within CiVSD with an amino acid sequence (KSRITSEGEYIPLDQIDINV) from the Kir2.1 channel Golgi-to-plasma membrane trafficking signal. The Kir 2.1 channel ER export signal sequence (FCYENEV) was added to C-terminus of super ecliptic pHluorin.
-
GenBank IDAB183035 AY533296
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SphI (not destroyed)
- 5′ sequencing primer gacgtaaatgggcggtaggcgtg
- 3′ sequencing primer ccttgagcatctgacttctggcta
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A portion of this plasmid was derived from a plasmid made by Dr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV Marina-T2A-nls-mCherry was a gift from Vincent Pieribone (Addgene plasmid # 74216 ; http://n2t.net/addgene:74216 ; RRID:Addgene_74216) -
For your References section:
Directed evolution of key residues in fluorescent protein inverses the polarity of voltage sensitivity in the genetically-encoded indicator ArcLight. Platisa J, Vasan G, Yang A, Pieribone VA. ACS Chem Neurosci. 2017 Jan 3. doi: 10.1021/acschemneuro.6b00234. 10.1021/acschemneuro.6b00234 PubMed 28045247