Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLenti-CaMKIIa-Archer1-EGFP
(Plasmid #60423)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60423 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 9241
  • Total vector size (bp) 10843
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use recombinase-free E. coli
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Archer1-EGFP
  • Alt name
    ArchDETC
  • Species
    H. sodomense
  • Insert Size (bp)
    1602
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TTCTCCGTTTGCACTCAGGAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    This plasmid backbone containing wild-type Arch and a different fusion protein (pLenti-CaMKIIa-eArch 3.0-EYFP) was deposited at Addgene by the Deisseroth lab.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CaMKIIa-Archer1-EGFP was a gift from Viviana Gradinaru (Addgene plasmid # 60423 ; http://n2t.net/addgene:60423 ; RRID:Addgene_60423)
  • For your References section:

    Archaerhodopsin variants with enhanced voltage-sensitive fluorescence in mammalian and Caenorhabditis elegans neurons. Flytzanis NC, Bedbrook CN, Chiu H, Engqvist MK, Xiao C, Chan KY, Sternberg PW, Arnold FH, Gradinaru V. Nat Commun. 2014 Sep 15;5:4894. doi: 10.1038/ncomms5894. 10.1038/ncomms5894 PubMed 25222271