Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-CMV-iRFP
(Plasmid #64887)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64887 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-CMV
  • Backbone manufacturer
    Cell Biolabs
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    iRFP
  • Species
    Rhodopseudomonas palustris
  • Insert Size (bp)
    948
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer pCAX-F (CAGCTCCTGGGCAACGTGC)
  • 3′ sequencing primer C-CMV-24 (TATTAGGACAAGGCTGGTGGGCAC)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The iRFP insert from pShuttle-CMV-iRFP DNA plasmid (Addgene Plasmid 31856) was used for pAAV-CMV-iRFP.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMV-iRFP was a gift from Tomomi Ichinose (Addgene plasmid # 64887 ; http://n2t.net/addgene:64887 ; RRID:Addgene_64887)
  • For your References section:

    Marking cells with infrared fluorescent proteins to preserve photoresponsiveness in the retina. Fyk-Kolodziej B, Hellmer CB, Ichinose T. Biotechniques. 2014 Nov 1;57(5):245-53. doi: 10.2144/000114228. eCollection 2014 Nov. 10.2144/000114228 PubMed 25391913