Skip to main content
Addgene
Open Menu

pcDNA3/Flag-METTL14
(Plasmid #53740)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53740 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 53740-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 53740-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 6759
  • Modifications to backbone
    N.A.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    N.A.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Methyltransferase-like 14
  • Alt name
    METTL14
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1371
  • GenBank ID
    NM_020961.2
  • Entrez Gene
    METTL14 (a.k.a. hMETTL14)
  • Promoter T7
  • Tag / Fusion Protein
    • FLAG tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer 5' TAATACGACTCACTATAGGG 3'
  • 3′ sequencing primer 5' ATTTAGGTGACACTATAG 3'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA was obtained from Open Biosystems

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3/Flag-METTL14 was a gift from Chuan He (Addgene plasmid # 53740 ; http://n2t.net/addgene:53740 ; RRID:Addgene_53740)

  • For your References section:

    A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Liu J, Yue Y, Han D, Wang X, Fu Y, Zhang L, Jia G, Yu M, Lu Z, Deng X, Dai Q, Chen W, He C. Nat Chem Biol. 2014 Feb;10(2):93-5. doi: 10.1038/nchembio.1432. Epub 2013 Dec 6. 10.1038/nchembio.1432 PubMed 24316715
Related items:
Commonly requested with: