Skip to main content

pAAV-EF1a-mCherry-IRES-Flpo
(Plasmid and Viral Vector Preps for #55634)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 55634 Standard format: Plasmid sent in bacteria as agar stab 1 $94
AAV1 55634-AAV1 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $459
AAV Retrograde 55634-AAVrg Virus (100µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $459

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 5315
  • Total vector size (bp) 7888
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    708
  • Promoter Ef1a

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer CACCCACACAAAGGAAAAGGGCC
  • 3′ sequencing primer CTTATACACGTGGCTTTTGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Flpo
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1272
  • Promoter Ef1a/IRES

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer aaccccccacctggcgacag
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use AAV1 particles produced from pAAV-EF1a-mCherry-IRES-Flpo (#55634). In addition to the viral particles, you will also receive purified pAAV-EF1a-mCherry-IRES-Flpo plasmid DNA.

EF1a-driven mCherry and bicistronic Flp recombinase expression. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Purpose

Ready-to-use AAV Retrograde particles produced from pAAV-EF1a-mCherry-IRES-Flpo (#55634). In addition to the viral particles, you will also receive purified pAAV-EF1a-mCherry-IRES-Flpo plasmid DNA.

Flpo and bicistronic (IRES) mCherry expression under the EF1a promoter. These AAV preparations are suitable purity for injection into animals. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
  • Serotype AAV retrograde (AAVrg)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-mCherry-IRES-Flpo was a gift from Karl Deisseroth (Addgene plasmid # 55634 ; http://n2t.net/addgene:55634 ; RRID:Addgene_55634) For viral preps, please replace (Addgene plasmid # 55634) in the above sentence with: (Addgene viral prep # 55634-AAV1) or (Addgene viral prep # 55634-AAVrg)
  • For your References section:

    Targeting cells with single vectors using multiple-feature Boolean logic. Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone J, Selimbeyoglu A, Berndt A, Grosenick L, Zalocusky KA, Bernstein H, Swanson H, Perry C, Diester I, Boyce FM, Bass CE, Neve R, Huang ZJ, Deisseroth K. Nat Methods. 2014 Jul;11(7):763-72. doi: 10.1038/nmeth.2996. Epub 2014 Jun 8. 10.1038/nmeth.2996 PubMed 24908100