Skip to main content

pCMV-HA-mIFITM3-C71,72,105A
(Plasmid #58396)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58396 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 58396-D50 50 μg of DNA in Tris buffer $495
DNA 58396-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV-HA
  • Backbone manufacturer
    clontech
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 4211
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IFITM3
  • Species
    M. musculus (mouse)
  • Mutation
    Cysteines 71, 72, and 105 to Alanine
  • Entrez Gene
    Ifitm3 (a.k.a. 1110004C05Rik, Cd225, Cdw217, DSPA2b, Fgls, IP15, mil-1)
  • Promoter CMV IE
  • Tag / Fusion Protein
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-HA-mIFITM3-C71,72,105A was a gift from Howard Hang & Jacob Yount (Addgene plasmid # 58396 ; http://n2t.net/addgene:58396 ; RRID:Addgene_58396)
  • For your References section:

    Palmitoylome profiling reveals S-palmitoylation-dependent antiviral activity of IFITM3. Yount JS, Moltedo B, Yang YY, Charron G, Moran TM, Lopez CB, Hang HC. Nat Chem Biol. 2010 Aug;6(8):610-4. doi: 10.1038/nchembio.405. Epub 2010 Jul 4. 10.1038/nchembio.405 PubMed 20601941