pCMV-HA-mIFITM3-C105A
(Plasmid
#58392)
-
PurposeExpressed murine IFITM3-C105A with an N-terminal HA tag in mammalian cells
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58392 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV-HA
-
Backbone manufacturerclontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 4211
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIFITM3
-
SpeciesM. musculus (mouse)
-
MutationCysteine 105 to Alanine
-
Entrez GeneIfitm3 (a.k.a. 1110004C05Rik, Cd225, Cdw217, DSPA2b, Fgls, IP15, mil-1)
- Promoter CMV IE
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-HA-mIFITM3-C105A was a gift from Howard Hang & Jacob Yount (Addgene plasmid # 58392 ; http://n2t.net/addgene:58392 ; RRID:Addgene_58392) -
For your References section:
Palmitoylome profiling reveals S-palmitoylation-dependent antiviral activity of IFITM3. Yount JS, Moltedo B, Yang YY, Charron G, Moran TM, Lopez CB, Hang HC. Nat Chem Biol. 2010 Aug;6(8):610-4. doi: 10.1038/nchembio.405. Epub 2010 Jul 4. 10.1038/nchembio.405 PubMed 20601941