-
PurposeExpresses nuclear EGFP and Tomato in mammalian cells
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59763 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 59763-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 59763-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepUC
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert named2-EGFP
-
Alt namedestablized EGFP
-
Insert Size (bp)935
- Promoter SV40 promoter
-
Tags
/ Fusion Proteins
- 3X NLS (N terminal on insert)
- PEST (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer GACGAAAGATTGGTGTGGAAAGTCC
- 3′ sequencing primer atcatcctgctcctccacctcc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTomato
-
Alt namemonomeric Tomato
-
Insert Size (bp)785
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- 3X NLS (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CACTGCAATCTCGTGATACGCCTA
- 3′ sequencing primer tgatgagtttggacaaaccacaac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 59763-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 59763-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNSEN-d2 was a gift from Jerry Crabtree (Addgene plasmid # 59763 ; http://n2t.net/addgene:59763 ; RRID:Addgene_59763) -
For your References section:
MicroRNA-mediated switching of chromatin-remodelling complexes in neural development. Yoo AS, Staahl BT, Chen L, Crabtree GR. Nature. 2009 Jul 30;460(7255):642-6. doi: 10.1038/nature08139. Epub 2009 Jun 28. 10.1038/nature08139 PubMed 19561591