NaChBac pTracer CMV2
(Plasmid
#60835)
-
PurposeMammalian expression plasmid containing NaChBac gene with an EGFP reporter
-
Depositing Lab
-
Depositing OrganizationBoston Children's Hospital
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60835 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 60835-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 60835-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneModified pTracer™-CMV2
- Backbone size w/o insert (bp) 6210
- Total vector size (bp) 6500
-
Vector typeMammalian Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNaChBac
-
Alt nameNavBh
-
SpeciesBacillus Hallodurans C-125
-
Insert Size (bp)825
-
GenBank IDNP_242367.1
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGC AAA TGG GCG GTA GGC GTG
- 3′ sequencing primer CACGCCTACCGCCCATTTGCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
NOTE: The EGFP in this plasmid does has some discrepancies with the EGFP reported in the standard pTracer™-CMV2. These modifications do not appear to change the function or effectivity of the EGFP.
DNA (Catalog # 60835-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 60835-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NaChBac pTracer CMV2 was a gift from David Clapham (Addgene plasmid # 60835 ; http://n2t.net/addgene:60835 ; RRID:Addgene_60835) -
For your References section:
A prokaryotic voltage-gated sodium channel. Ren D, Navarro B, Xu H, Yue L, Shi Q, Clapham DE. Science. 2001 Dec 14;294(5550):2372-5. 10.1126/science.1065635 PubMed 11743207