pXFokI-dCas9
(Plasmid
#60901)
-
Purpose(Empty Backbone) Dual Expression Vector for FokI-dCas9 and gRNA
-
Depositing Lab
-
Depositing OrganizationJ. David Gladstone Institutes
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60901 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC ori vector
- Backbone size (bp) 9070
-
Vector typeMammalian Expression, CRISPR
- Promoter CBh and U6
-
Tag
/ Fusion Protein
- 3XFLAG (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe plasmid is generated by replacing Cas9 D10A nickase in pX335 from the Zhang laboratory with FokI-dCas9 from pSQT1601 from the Joung laboratory.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The gRNA cloning strategy is exactly the same as for pX330/pX335.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXFokI-dCas9 was a gift from Bruce Conklin (Addgene plasmid # 60901 ; http://n2t.net/addgene:60901 ; RRID:Addgene_60901) -
For your References section:
Systematic quantification of HDR and NHEJ reveals effects of locus, nuclease, and cell type on genome-editing. Miyaoka Y, Berman JR, Cooper SB, Mayerl SJ, Chan AH, Zhang B, Karlin-Neumann GA, Conklin BR. Sci Rep. 2016 Mar 31;6:23549. doi: 10.1038/srep23549. 10.1038/srep23549 PubMed 27030102