-
Purposeco-expressing Cas9 and Cre recombinase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68468 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCas9-2A-GFP
-
Modifications to backboneCas9-2A-Cre was constructed by replacing GFP in the Cas9-2A-GFP (Addgene plasmid #44719) with the Cre cDNA amplified frompCAG-Cre (Addgene plasmid #13775)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9 and Cre recombinase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5288
- Promoter CAG
-
Tag
/ Fusion Protein
- P2A-Cre-Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer ggctctagtgcctctgctaacc
- 3′ sequencing primer M13R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cas9-2A-Cre was a gift from Su-Chun Zhang (Addgene plasmid # 68468 ; http://n2t.net/addgene:68468 ; RRID:Addgene_68468) -
For your References section:
Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Chen Y, Cao J, Xiong M, Petersen AJ, Dong Y, Tao Y, Huang CT, Du Z, Zhang SC. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001. 10.1016/j.stem.2015.06.001 PubMed 26145478