Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #68407)


Item Catalog # Description Quantity Price (USD)
Plasmid 68407 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Frederick National Lab
  • Backbone size (bp) 4800
  • Modifications to backbone
    PL552 donor plasmid vector containing a floxed PGK-puromycin expression cassette was constructed by replacing the neomycin gene in the PL452 (Frederick National Lab) with a puromycin gene.
  • Vector type
    Mammalian Expression, Cre/Lox
  • Promoter mouse PGK promoter
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer agctatgaccatgattacg
  • 3′ sequencing primer aaacgacggccagtgaattg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PL552 was a gift from Su-Chun Zhang (Addgene plasmid # 68407 ; ; RRID:Addgene_68407)
  • For your References section:

    Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Chen Y, Cao J, Xiong M, Petersen AJ, Dong Y, Tao Y, Huang CT, Du Z, Zhang SC. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001. 10.1016/j.stem.2015.06.001 PubMed 26145478