pPL5617_pUG_PuroR
(Plasmid #60928)

• Purpose: PCR template vector for generating puromycin resistance cassette.
• Depositing Lab: Robert Piper
• Publication: MacDonald et al Yeast. 2015 Feb 16. doi: 10.1002/yea.3069.

Backbone

• Vector backbone: pUG27
• Vector type: LoxP flanked deletion cassette template
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: puromycin N-Acetyltransferase
• Alt name: pac
• Insert Size (bp): 597
• Promoter: TEF1

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ggttcttctttcatatacttcc
• 3′ sequencing primer: gggcagatgatgtcgaggcg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: They were gene synthesized using a commercial service, which made them according to our design.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Puromycin resistance gene from Streptomyces alboniger; codon optimized for expression in Saccharomyces cerevisiae