Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMTB-Multibow-fR
(Plasmid #60984)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60984 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mKate2
  • Species
    Synthetic
  • Promoter Bactin2

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer SP6
  • 3′ sequencing primer CAGCAGGACCATTTATCATGCTGCTGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMTB-Multibow-fR was a gift from Sean Megason (Addgene plasmid # 60984 ; http://n2t.net/addgene:60984 ; RRID:Addgene_60984)
  • For your References section:

    Multibow: digital spectral barcodes for cell tracing. Xiong F, Obholzer ND, Noche RR, Megason SG. PLoS One. 2015 May 26;10(5):e0127822. doi: 10.1371/journal.pone.0127822. eCollection 2015. PONE-D-14-56414 [pii] PubMed 26010570