Skip to main content

eGFPbait-E2A-KalTA4-pA donor vector
(Plasmid #61069)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61069 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 61069-D50 50 μg of DNA in Tris buffer $495
DNA 61069-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCRII-TOPO
  • Backbone manufacturer
    Invitrogen
  • Total vector size (bp) 5759
  • Vector type
    zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    eGFPbait
  • Species
    Synthetic
  • Insert Size (bp)
    236

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    KalTA4
  • Alt name
    optimized Gal4-activator
  • Species
    Synthetic
  • Insert Size (bp)
    1497
  • Tag / Fusion Protein
    • E2A (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer M13-F
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The eGFPbait-E2A-KalTA4 donor plasmid was generated by forward insertion of a PCR-amplified eGFP fragment into the pCRII-TOPO vector. Primers used were eGFP_fwd: ATAGTGGTACCATGGTGAGCAAGGGCGAGGAGC, and eGFP_rev: GTAGCGGCTGAAGCACTGCACGC. The E2A-KalTA4-pA fragment was generated by fusion of individual PCR products using Phusion High-Fidelity DNA Polymerase (Thermo Scientific); E2A was amplified with the primers E2A_fwd: TGCAGATATCCAGGAGGAGGACAGTGTACTAATTATGCTC, E2A_rev: TTCCTCCTCCGGGACCTGGGTTGCTC from a previously generated E2A sequence (Szymczak et al. 2004, PMID 15064769). KalTA4-pA was amplified with KalTA4_fwd: CCCAGGTCCCGGAGGAGGAAAACTGCTC, KalTA4_rev: CATGCTCGAGTCCACTAGTTCTAGAGCG, using the 4 × Kaloop vector as template (Distel et al. 2009, PMID 19628697). Subsequently, both fragments were fused, amplified, and inserted into pCRII-TOPO-eGFPbait with EcoRV and XhoI.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eGFPbait-E2A-KalTA4-pA donor vector was a gift from Filippo Del Bene (Addgene plasmid # 61069 ; http://n2t.net/addgene:61069 ; RRID:Addgene_61069)
  • For your References section:

    Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Auer TO, Duroure K, De Cian A, Concordet JP, Del Bene F. Genome Res. 2014 Jan;24(1):142-53. doi: 10.1101/gr.161638.113. Epub 2013 Oct 31. 10.1101/gr.161638.113 PubMed 24179142