gRNA-hIRF-1 #12
(Plasmid
#61079)
-
PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoter
-
Depositing Lab
-
Depositing OrganizationThe University of Osaka
Located in Japan -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 61079-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 61079-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCR-Blunt II-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3400
- Total vector size (bp) 3974
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA_hIRF1 promoter #12
-
SpeciesH. sapiens (human)
-
Insert Size (bp)555
-
GenBank IDDQ789232.1
-
Entrez GeneIRF1 (a.k.a. IMD117, IRF-1, MAR)
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer T7
- 3′ sequencing primer M13 reverse
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence: CCGGGGGCGCTGGGCTGTCCCGG
DNA (Catalog # 61079-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 61079-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNA-hIRF-1 #12 was a gift from Hodaka Fujii (Addgene plasmid # 61079 ; http://n2t.net/addgene:61079 ; RRID:Addgene_61079) -
For your References section:
Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR. Fujita T, Fujii H. Biochem Biophys Res Commun. 2013 Sep 13;439(1):132-6. doi: 10.1016/j.bbrc.2013.08.013. Epub 2013 Aug 11. 10.1016/j.bbrc.2013.08.013 PubMed 23942116
Map uploaded by the depositor.
