-
PurposeCre-dependent Cas9 expression plasmid and targeting vector for the mouse Rosa26 locus. Cas9 expression is Cre-dependent and the targeting vector has positive (Neo) and negative (DTA) selection.
-
Depositing Lab
-
Depositing OrganizationBroad Institute
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61408 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 61408-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 61408-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneAi9
- Backbone size w/o insert (bp) 14500
- Total vector size (bp) 20541
-
Vector typeMammalian Expression, Mouse Targeting, Cre/Lox, CRISPR
-
Selectable markersNeomycin (select with G418) ; DTA
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsPlease note that this plasmid is prone to recombination. We recommend screening 3-5 colonies to ensure the full plasmid is intact.
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas9
-
SpeciesSynthetic; streptococcus pyogenes
-
Insert Size (bp)4101
-
Mutationhuman codon optimized
- Promoter CAG
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- P2A (C terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer atgtctggatccccatcaagc
- 3′ sequencing primer CTGCTTGTCGGCCATGATATAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP
-
Insert Size (bp)714
- Promoter CAG
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTCTCAGCTGGGAGGCGAC
- 3′ sequencing primer gtatccacatagcgtaaaaggagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 61408-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 61408-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LSL-Cas9-Rosa26TV was a gift from Feng Zhang (Addgene plasmid # 61408 ; http://n2t.net/addgene:61408 ; RRID:Addgene_61408) -
For your References section:
CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, Parnas O, Eisenhaure TM, Jovanovic M, Graham DB, Jhunjhunwala S, Heidenreich M, Xavier RJ, Langer R, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. 10.1016/j.cell.2014.09.014 PubMed 25263330