Skip to main content
Addgene
Open Menu

ER-ABKAR
(Plasmid #61508)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61508 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 61508-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 61508-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AMPK Biosensor
  • Promoter CMV
  • Tag / Fusion Protein
    • ER targeting sequence from CYP450 2C1 (see comments) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert prepared from CYP450-containing plasmid gifted by Xin. ER targeting sequence from CYP450 2C1: ATGGACCCTGTGGTGGTGCTGGGGCTCTGTCTCTCCTGTTTGCTTCTCCTTTCACTCTGGAAACAGAGCTATGGGGG

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ER-ABKAR was a gift from Takanari Inoue & Jin Zhang (Addgene plasmid # 61508 ; http://n2t.net/addgene:61508 ; RRID:Addgene_61508)

  • For your References section:

    Compartmentalized AMPK signaling illuminated by genetically encoded molecular sensors and actuators. Miyamoto T, Rho E, Sample V, Akano H, Magari M, Ueno T, Gorshkov K, Chen M, Tokumitsu H, Zhang J, Inoue T. Cell Rep. 2015 Apr 28;11(4):657-70. doi: 10.1016/j.celrep.2015.03.057. Epub 2015 Apr 16. 10.1016/j.celrep.2015.03.057 PubMed 25892241
Related items:
Commonly requested with: