-
PurposeFor mRNA synthesis or expression in mammalian cells
-
Depositing Lab
-
Depositing OrganizationBoston Children's Hospital
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61831 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 61831-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 61831-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA
- Backbone size w/o insert (bp) 5700
- Total vector size (bp) 7226
-
Modifications to backboneflag and polyA sequences were added to 5' and 3' side of insert, respectively.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameZscan4d
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1515
-
Entrez GeneZscan4d (a.k.a. EG545913)
- Promoter CMV and T7
-
Tag
/ Fusion Protein
- flag (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cactgcttactggcttatcg
- 3′ sequencing primer cgtttacaggttctttggtg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 61831-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 61831-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA-flag-mZscan4d-polyA was a gift from Yi Zhang (Addgene plasmid # 61831 ; http://n2t.net/addgene:61831 ; RRID:Addgene_61831) -
For your References section:
Embryonic Development following Somatic Cell Nuclear Transfer Impeded by Persisting Histone Methylation. Matoba S, Liu Y, Lu F, Iwabuchi KA, Shen L, Inoue A, Zhang Y. Cell. 2014 Nov 6;159(4):884-95. doi: 10.1016/j.cell.2014.09.055. Epub 2014 Oct 30. 10.1016/j.cell.2014.09.055 PubMed 25417163