ptreCas9-mKate2ps-T1gRNA
(Plasmid
#62715)
-
PurposeInducible; gRNA seq is ATGAGAATCAAGGCGGTCGA
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas at Dallas
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62715 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 62715-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 62715-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTag-CFP
- Total vector size (bp) 9281
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9–mKate2ps
-
SpeciesSynthetic
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Discrepancies between the full and QC sequence are of no functional consequence.
DNA (Catalog # 62715-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 62715-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ptreCas9-mKate2ps-T1gRNA was a gift from Leonidas Bleris (Addgene plasmid # 62715 ; http://n2t.net/addgene:62715 ; RRID:Addgene_62715) -
For your References section:
CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Moore R, Spinhirne A, Lai MJ, Preisser S, Li Y, Kang T, Bleris L. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18. 10.1093/nar/gku1326 PubMed 25527740