Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells.
Moore R, Spinhirne A, Lai MJ, Preisser S, Li Y, Kang T, Bleris L
Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18.
PubMed Article

Plasmids from Article

ID Plasmid Purpose  
62715ptreCas9-mKate2ps-T1gRNAInducible; gRNA seq is ATGAGAATCAAGGCGGTCGA
62716pCas9–mKate2ps–EgRNAEmpty; no U6 gRNA cassette
64955pCas9–mKate2ps–CgRNAControl gRNA (GTCAAGGCACTCTTGCCTA)