pGoldyTALEN-VIM-TAL-1
(Plasmid #62855)

• Purpose: TALEN mediated gene editing at human VIM locus
• Depositing Lab: Gaudenz Danuser
• Publication: Gan et al Cell Syst. 2016 Sep 21. pii: S2405-4712(16)30262-9. doi: 10.1016/j.cels.2016.08.007.

Backbone

• Vector backbone: pBSK
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 5563
• Vector type: Mammalian Expression, TALEN

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TALEN array
• Species: Synthetic
• Insert Size (bp): 1508
• Promoter: miniCAGG

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: catcgcgcaatgcactgac
• 3′ sequencing primer: attcagatttcactagctgggatc

Resource Information

• Supplemental Documents:
  • GenBank file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pCGS652 from the Voytas lab was used for Golden Gate assembly.