Mucolipin1 D471-472K-pHcRed C1
(Plasmid
#62961)
-
Purposefull length human Mucolipin-1 D471/472K cloned into pHcRed1 C1
-
Depositing Lab
-
Depositing OrganizationUniversity of Cambridge
Located in the United Kingdom of Great Britain and Northern Ireland -
Publication
-
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62961 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 62961-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 62961-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepHcRed1 C1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMucolipin-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1761
-
MutationD471/472K (and two silent mutations T77 ACA instead of ACG N328 AAT instead of AAC)
-
GenBank IDNM_020533.2 Q9GZU1
-
Entrez GeneMCOLN1 (a.k.a. LECD, MG-2, ML1, ML4, MLIV, MST080, MSTP080, TRP-ML1, TRPM-L1, TRPML1)
- Promoter CMV
-
Tag
/ Fusion Protein
- HcRed (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer 5’ CACCGACATCCGGCTCCAGATG 3’
- 3′ sequencing primer 5’ GGACAAACCACAACTAGAATGCAGTG 3’
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 62961-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 62961-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Mucolipin1 D471-472K-pHcRed C1 was a gift from Paul Luzio (Addgene plasmid # 62961 ; http://n2t.net/addgene:62961 ; RRID:Addgene_62961) -
For your References section:
Mucolipin-1 is a lysosomal membrane protein required for intracellular lactosylceramide traffic. Pryor PR, Reimann F, Gribble FM, Luzio JP. Traffic. 2006 Oct;7(10):1388-98. 10.1111/j.1600-0854.2006.00475.x PubMed 16978393