Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Mucolipin1-pEGFP C3
(Plasmid #62960)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62960 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP C3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mucolipin-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1761
  • Mutation
    Mucolipin-1 has 1 silent mutation compared to the coding sequence of NM_020533.2 N328 AAT instead of AAC
  • GenBank ID
    NM_020533.2 Q9GZU1
  • Entrez Gene
    MCOLN1 (a.k.a. MG-2, ML1, ML4, MLIV, MST080, MSTP080, TRP-ML1, TRPM-L1, TRPML1)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer 5’ CCGACAACCACTACCTGAGC 3’
  • 3′ sequencing primer 5’ ACAAACCACAACTAGAATGCAG 3’
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Mucolipin1-pEGFP C3 was a gift from Paul Luzio (Addgene plasmid # 62960 ; http://n2t.net/addgene:62960 ; RRID:Addgene_62960)
  • For your References section:

    Mucolipin-1 is a lysosomal membrane protein required for intracellular lactosylceramide traffic. Pryor PR, Reimann F, Gribble FM, Luzio JP. Traffic. 2006 Oct;7(10):1388-98. 10.1111/j.1600-0854.2006.00475.x PubMed 16978393