Skip to main content
Addgene
Open Menu

Mucolipin1-pEGFP C3
(Plasmid #62960)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 62960 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 62960-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 62960-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEGFP C3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mucolipin-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1761
  • Mutation
    Mucolipin-1 has 1 silent mutation compared to the coding sequence of NM_020533.2 N328 AAT instead of AAC
  • GenBank ID
    NM_020533.2 Q9GZU1
  • Entrez Gene
    MCOLN1 (a.k.a. LECD, MG-2, ML1, ML4, MLIV, MST080, MSTP080, TRP-ML1, TRPM-L1, TRPML1)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer 5’ CCGACAACCACTACCTGAGC 3’
  • 3′ sequencing primer 5’ ACAAACCACAACTAGAATGCAG 3’
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Mucolipin1-pEGFP C3 was a gift from Paul Luzio (Addgene plasmid # 62960 ; http://n2t.net/addgene:62960 ; RRID:Addgene_62960)

  • For your References section:

    Mucolipin-1 is a lysosomal membrane protein required for intracellular lactosylceramide traffic. Pryor PR, Reimann F, Gribble FM, Luzio JP. Traffic. 2006 Oct;7(10):1388-98. 10.1111/j.1600-0854.2006.00475.x PubMed 16978393
Related items:
Commonly requested with: