Skip to main content

pMarsL274G
(Plasmid #63177)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63177 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 63177-D50 50 μg of DNA in Tris buffer $495
DNA 63177-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1+
  • Total vector size (bp) 8086
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MarsL274G
  • Alt name
    Mars
  • Alt name
    methionine-tRNA synthetase (L274G)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2753
  • Mutation
    L274G
  • GenBank ID
    NP_001003913
  • Entrez Gene
    Mars1 (a.k.a. Mars, Metrs, Mtrns)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (not destroyed)
  • 3′ cloning site xho1 (not destroyed)
  • 5′ sequencing primer GCTCTCTGGCTAACTAGAGAACCCACTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Developed by Alborz Mahdavi.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMarsL274G was a gift from David Tirrell (Addgene plasmid # 63177 ; http://n2t.net/addgene:63177 ; RRID:Addgene_63177)
  • For your References section:

    Engineered Aminoacyl-tRNA Synthetase for Cell-Selective Analysis of Mammalian Protein Synthesis. Mahdavi A, Hamblin GD, Jindal GA, Bagert JD, Dong C, Sweredoski MJ, Hess S, Schuman EM, Tirrell DA. J Am Chem Soc. 2016 Apr 6;138(13):4278-81. doi: 10.1021/jacs.5b08980. Epub 2016 Mar 25. 10.1021/jacs.5b08980 PubMed 26991063