Skip to main content
Addgene
Open Menu

pLPhygCAS9
(Plasmid #63555)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63555 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 63555-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 63555-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pLPHyg2
  • Backbone size w/o insert (bp) 5747
  • Total vector size (bp) 10112
  • Vector type
    Leishmania Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Humanized Streptococcus pyogenes Cas9 from PX330 (Addgene)
  • Alt name
    CAS9
  • Species
    Streptococcus pyogenes
  • Tag / Fusion Protein
    • flag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind III (not destroyed)
  • 3′ cloning site BamH I (not destroyed)
  • 5′ sequencing primer aagcttagcacctgcctgaaatcact
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The Humanized Streptococcus pyogenes Cas9 gene was derived from pX330 plasmid distributed by Addgene ( Dr Feng Zhang, Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLPhygCAS9 was a gift from Greg Matlashewski (Addgene plasmid # 63555 ; http://n2t.net/addgene:63555 ; RRID:Addgene_63555)

  • For your References section:

    CRISPR-Cas9-Mediated Genome Editing in Leishmania donovani. Zhang WW, Matlashewski G. MBio. 2015 Jul 21;6(4). pii: e00861-15. doi: 10.1128/mBio.00861-15. 10.1128/mBio.00861-15 PubMed 26199327
Related items:
Commonly requested with: