TetO-FUW-NfiA
(Plasmid #64901)

• Purpose: Inducible expression of murine CDS encoding for NfiA. Toghther with TetO-FUW-Sox9 and TetO-FUW-NfiB allows reprograming into iAstro. cells.
• Depositing Lab: Vania Broccoli
• Publication: Caiazzo et al Stem Cell Reports. 2015 Jan 13;4(1):25-36. doi: 10.1016/j.stemcr.2014.12.002. Epub 2014 Dec 31.

Backbone

• Vector backbone: TetO-FUW
• Backbone size w/o insert (bp): 8421
• Total vector size (bp): 9971
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Nfia
• Alt name: Ctf
• Species: M. musculus (mouse)
• Insert Size (bp): 1558
• GenBank ID: 18027
• Entrez Gene: Nfia (a.k.a. 1110047K16Rik, 9430022M17Rik, CTF, NF1-A, NF1A)
• Promoter: TetO

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hpa (destroyed during cloning)
• 3′ cloning site: Nhe (not destroyed)
• 5′ sequencing primer: GCAGAGCTCGTTTAGTGAACCGTC
• 3′ sequencing primer: AGCAGCGTATCCACATAGCG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: NfiA coding was kindly Provided by Dr G. Messina
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry