SLC30A10-delta105-107
(Plasmid #65205)

• Purpose: Constitutive expression of SLC30A10 delta 105-107 in mammalian cells
• Depositing Lab: Somshuvra Mukhopadhyay
• Publication: Leyva-Illades et al J Neurosci. 2014 Oct 15;34(42):14079-95. doi: 10.1523/JNEUROSCI.2329-14.2014.

Backbone

• Vector backbone: pCMV-Flag-10
• Backbone manufacturer: Sigma
• Backbone size w/o insert (bp): 6400
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SLC30A10
• Species: H. sapiens (human)
• Insert Size (bp): 1446
• Mutation: delta 105-107 amino acids
• Entrez Gene: SLC30A10 (a.k.a. HMDPC, HMNDYT1, ZNT10, ZNT8, ZRC1, ZnT-10)
• Promoter: CMV
• Tag / Fusion Protein:
  • Flag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CMV Forward
• 3′ sequencing primer: C-CMV-24 (TATTAGGACAAGGCTGGTGGGCAC)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: SC30A10 WT received from Dr. Ruth Valentine

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Amino acids 105-107 were deleted by Quikchange.