Skip to main content

IRES-GFP-AXL-KD
(Plasmid #65498)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65498 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 65498-D50 50 μg of DNA in Tris buffer $495
DNA 65498-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pIRES2-EGFP
  • Backbone manufacturer
    Clonetech
  • Backbone size w/o insert (bp) 5300
  • Total vector size (bp) 7927
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tyrosine-protein kinase receptor UFO
  • Alt name
    AXL
  • Alt name
    UFO
  • Alt name
    AXL oncogene
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2682
  • Mutation
    K567R
  • GenBank ID
    AAH32229.1
  • Entrez Gene
    AXL (a.k.a. ARK, AXL3, JTK11, Tyro7, UFO)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CTGGTCGAGCTGGACGGCGACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    IRES-GFP-AXL-KD was a gift from Aaron Meyer (Addgene plasmid # 65498 ; http://n2t.net/addgene:65498 ; RRID:Addgene_65498)
  • For your References section:

    The AXL Receptor is a Sensor of Ligand Spatial Heterogeneity. Meyer AS, Zweemer AJ, Lauffenburger DA. Cell Syst. 2015 Jul 29;1(1):25-36. 10.1016/j.cels.2015.06.002 PubMed 26236777