pWY82
(Plasmid #65721)

• Purpose: Plasmid with telomere sequence
• Depositing Lab: James Birchler
• Publication: Yu et al Proc Natl Acad Sci U S A. 2006 Nov 14;103(46):17331-6. Epub 2006 Nov 3.
• Citations: 3 Articles

Backbone

• Vector backbone: pTF101.1
• Backbone size w/o insert (bp): 9189
• Total vector size (bp): 11656
• Vector type: Plant Expression
• Selectable markers: Basta

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin and Streptomycin, 50 & 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl2
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Telomere
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 2500

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI,EcoRI (not destroyed)
• 3′ cloning site: NcoI,EcoRV (not destroyed)
• 5′ sequencing primer: gggcgacgtcgactgttta
• 3′ sequencing primer: TCACACAGGAAACAGCTATGAC

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that Addgene NGS found a 1.5kb deletion in the telomere repeats as compared to the original depositor sequence. The depositor has confirmed that the telomere sequence in the plasmid is inherently unstable, and that the plasmid is still functional for telomere truncation.

The plasmid was also verified by restriction digest. The gel image is provided on this page under- Resource Information- Addgene Notes.