Skip to main content

pTK305
(Plasmid #66812)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 66812 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 66812-D50 50 μg of DNA in Tris buffer $495
DNA 66812-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 1811
  • Total vector size (bp) 4112
  • Vector type
    Luciferase ; mRNA IVT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Firefly luciferase
  • Alt name
    Fluc
  • Species
    Photinus pyralis
  • Insert Size (bp)
    1650
  • Promoter T7

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer CACCGCGGCTGTAAATGTTT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTK305 was a gift from Ron Weiss (Addgene plasmid # 66812 ; http://n2t.net/addgene:66812 ; RRID:Addgene_66812)
  • For your References section:

    N-methylpseudouridine-incorporated mRNA outperforms pseudouridine-incorporated mRNA by providing enhanced protein expression and reduced immunogenicity in mammalian cell lines and mice. Andries O, Cafferty SM, De Smedt SC, Weiss R, Sanders NN, Kitada T. J Control Release. 2015 Sep 2. pii: S0168-3659(15)30094-8. doi: 10.1016/j.jconrel.2015.08.051. 10.1016/j.jconrel.2015.08.051 PubMed 26342664