Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMSCV-dCasRx-ALKBH5-PURO
(Plasmid #175582)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 175582 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCV
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCasRx-ALKBH5
  • Alt name
    NLS-dRfxCas13d-NLS-ALKBH5
  • Insert Size (bp)
    4668
  • Mutation
    RfxCas13d R239A/H244A/R858A/H863A
  • Promoter pMSCV
  • Tag / Fusion Protein
    • FLAG-HA (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CCCAAGAAGAAGAGAAAGGTGGAGG
  • 3′ sequencing primer GTGCCGCCGCATCTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-dCasRx-ALKBH5-PURO was a gift from Qi Xie (Addgene plasmid # 175582 ; http://n2t.net/addgene:175582 ; RRID:Addgene_175582)
  • For your References section:

    Epitranscriptomic editing of the RNA N6-methyladenosine modification by dCasRx conjugated methyltransferase and demethylase. Xia Z, Tang M, Ma J, Zhang H, Gimple RC, Prager BC, Tang H, Sun C, Liu F, Lin P, Mei Y, Du R, Rich JN, Xie Q. Nucleic Acids Res. 2021 Jul 21;49(13):7361-7374. doi: 10.1093/nar/gkab517. 10.1093/nar/gkab517 PubMed 34181729