pIVTRup
(Plasmid #101362)

• Purpose: Highly efficient in vitro transcription. Empty backbone.
• Depositing Lab: Ángel Raya
• Publication: pIVTRup (unpublished)

Backbone

• Vector backbone: pCRII topo-TA
• Backbone manufacturer: Invitrogene
• Backbone size w/o insert (bp): 3900
• Total vector size (bp): 4244
• Vector type: For cloning a gene for in vitro transcription purposes

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 5'UTR-EcoRV site-3'UTR-pAtrack(55 pA)
• Species: X. laevis (frog)
• Promoter: T7

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: M13F
• 3′ sequencing primer: M13R

Resource Information

• Supplemental Documents:
  • pIVTRup.gb
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is intended to be used as a platform for in vitro transcription. GOI can be cloned at EcoRV site in blunt. Template for IVT is obtained by PCR with forward primer consisting on a primer that contains the T7 promoter sequence and part of the 5’UTR (5’ TTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAG 3’) and a 55 polyT (or longer) as reverse primer. No need for polyA polimerase treatment after IVT. Resulting mRNA will contain 5’UTR-GOI-3’UTR-pA (55bp or longer) and it is ready to be transfected.
UTRs are from X. laevis and β-globin gene and can be used for H. sapiens and M. musculus.