Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTK305
(Plasmid #66812)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 66812 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 1811
  • Total vector size (bp) 4112
  • Vector type
    Luciferase ; mRNA IVT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Firefly luciferase
  • Alt name
    Fluc
  • Species
    Photinus pyralis
  • Insert Size (bp)
    1650
  • Promoter T7

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGG
  • 3′ sequencing primer CACCGCGGCTGTAAATGTTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTK305 was a gift from Ron Weiss (Addgene plasmid # 66812 ; http://n2t.net/addgene:66812 ; RRID:Addgene_66812)
  • For your References section:

    N-methylpseudouridine-incorporated mRNA outperforms pseudouridine-incorporated mRNA by providing enhanced protein expression and reduced immunogenicity in mammalian cell lines and mice. Andries O, Cafferty SM, De Smedt SC, Weiss R, Sanders NN, Kitada T. J Control Release. 2015 Sep 2. pii: S0168-3659(15)30094-8. doi: 10.1016/j.jconrel.2015.08.051. 10.1016/j.jconrel.2015.08.051 PubMed 26342664