1000.pCCLsin.cPPT.hPGK.Myt1L.MIRT124_x4 Xma_lost.WPRE
(Plasmid
#67293)
-
PurposeInduce human iN conversion from fibroblast
-
Depositing Lab
-
Depositing OrganizationLund University
Located in Sweden -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67293 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCCL-cppt-PGK-MIRT124_x4 Xma_lost.WPRE
- Backbone size w/o insert (bp) 7139
-
Modifications to backbone4x miR-124.T sequences (taaggcacgcggtgaatgcc) cloned downstream of WPRE
-
Vector typeMammalian Expression, Yeast Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMyt1L
-
Alt name2900046C06Rik
-
Alt name2900093J19Rik
-
Alt nameC630034G21Rik
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3577
-
GenBank IDNC_000078.6
-
Entrez GeneMyt1l (a.k.a. 2900046C06Rik, 2900093J19Rik, C630034G21Rik, Nztf1, Pmng1, Png-1, mKIAA1106)
- Promoter PGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer ggagcgcacgtcgg
- 3′ sequencing primer cagcaaccaggatttatacaagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1000.pCCLsin.cPPT.hPGK.Myt1L.MIRT124_x4 Xma_lost.WPRE was a gift from Malin Parmar (Addgene plasmid # 67293 ; http://n2t.net/addgene:67293 ; RRID:Addgene_67293) -
For your References section:
Direct neural conversion from human fibroblasts using self-regulating and nonintegrating viral vectors. Lau S, Rylander Ottosson D, Jakobsson J, Parmar M. Cell Rep. 2014 Dec 11;9(5):1673-80. doi: 10.1016/j.celrep.2014.11.017. Epub 2014 Dec 4. 10.1016/j.celrep.2014.11.017 PubMed 25482564