Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

1000.pCCLsin.cPPT.hPGK.Ascl1.WPRE
(Plasmid #67291)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 67291 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCCL-cppt-PGK-WPRE
  • Backbone size w/o insert (bp) 7041
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Asc1
  • Alt name
    Mash1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    696
  • GenBank ID
    NC_000076.6
  • Entrez Gene
    Ascl1 (a.k.a. AI225900, AS, ASH1, Mas, Mash1, bHLHa, bHLHa46)
  • Promoter PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ggagcgcacgtcgg
  • 3′ sequencing primer cagcaaccaggatttatacaagg
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1000.pCCLsin.cPPT.hPGK.Ascl1.WPRE was a gift from Malin Parmar (Addgene plasmid # 67291 ; http://n2t.net/addgene:67291 ; RRID:Addgene_67291)
  • For your References section:

    Direct neural conversion from human fibroblasts using self-regulating and nonintegrating viral vectors. Lau S, Rylander Ottosson D, Jakobsson J, Parmar M. Cell Rep. 2014 Dec 11;9(5):1673-80. doi: 10.1016/j.celrep.2014.11.017. Epub 2014 Dec 4. 10.1016/j.celrep.2014.11.017 PubMed 25482564