-
Depositing Lab
-
Depositing OrganizationLund University
Located in Sweden -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 33013 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCCL-cppt-PGK-WPRE
-
Backbone manufacturerMalin Parmar
- Backbone size w/o insert (bp) 7041
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLIM homeobox transcription factor 1 alpha
-
Alt nameLmx1a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1149
-
GenBank IDNM_033652.5
-
Entrez GeneLmx1a (a.k.a. Lmx1.1, dr, dreher, sst)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CAAGGCCTCGTTTGAAGTATCC
- 3′ sequencing primer TGTCTCCGCAGCCAGAGTCT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV.PGK.mLmx1a was a gift from Malin Parmar (Addgene plasmid # 33013 ; http://n2t.net/addgene:33013 ; RRID:Addgene_33013) -
For your References section:
Direct conversion of human fibroblasts to dopaminergic neurons. Pfisterer U, Kirkeby A, Torper O, Wood J, Nelander J, Dufour A, Bjorklund A, Lindvall O, Jakobsson J, Parmar M. Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10343-8. Epub 2011 Jun 6. 10.1073/pnas.1105135108 PubMed 21646515