Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLV.PGK.mLmx1a
(Plasmid #33013)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 33013 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCCL-cppt-PGK-WPRE
  • Backbone manufacturer
    Malin Parmar
  • Backbone size w/o insert (bp) 7041
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LIM homeobox transcription factor 1 alpha
  • Alt name
    Lmx1a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1149
  • GenBank ID
    NM_033652.5
  • Entrez Gene
    Lmx1a (a.k.a. Lmx1.1, dr, dreher, sst)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CAAGGCCTCGTTTGAAGTATCC
  • 3′ sequencing primer TGTCTCCGCAGCCAGAGTCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV.PGK.mLmx1a was a gift from Malin Parmar (Addgene plasmid # 33013 ; http://n2t.net/addgene:33013 ; RRID:Addgene_33013)
  • For your References section:

    Direct conversion of human fibroblasts to dopaminergic neurons. Pfisterer U, Kirkeby A, Torper O, Wood J, Nelander J, Dufour A, Bjorklund A, Lindvall O, Jakobsson J, Parmar M. Proc Natl Acad Sci U S A. 2011 Jun 21;108(25):10343-8. Epub 2011 Jun 6. 10.1073/pnas.1105135108 PubMed 21646515