Skip to main content

pGL3-MMLV-LTR-Luc
(Plasmid #67831)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 67831 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 67831-D50 50 μg of DNA in Tris buffer $495
DNA 67831-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL3-Basic Vector
  • Backbone manufacturer
    Promega
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MMLV-LTR + primer binding site
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer pGL3-R (CTTGGCATTCCGGTACTGTT)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-MMLV-LTR-Luc was a gift from Stephen Goff (Addgene plasmid # 67831 ; http://n2t.net/addgene:67831 ; RRID:Addgene_67831)
  • For your References section:

    Postentry restriction of Mason-Pfizer monkey virus in mouse cells. Wang GZ, Goff SP. J Virol. 2015 Mar;89(5):2813-9. doi: 10.1128/JVI.03051-14. Epub 2014 Dec 24. 10.1128/JVI.03051-14 PubMed 25540373