-
PurposeCas9 activity reporter with GFP and BFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67984 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepKLV2 lentiviral vector
- Backbone size w/o insert (bp) 5783
- Total vector size (bp) 8763
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameU6gRNA cassette, PGKGFP2ABFP cassette, WPRE
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)3011
-
MutationDeleted BbsI site within WPRE, modified BFP
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CATAATAGCAACAGACATAC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGuide RNA targeting modified BFP
-
Insert Size (bp)20
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GTAATAATTTCTTGGGTAGT
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV2-U6gRNA5(gBFP)-PGKGFP2ABFP-W was a gift from Kosuke Yusa (Addgene plasmid # 67984 ; http://n2t.net/addgene:67984 ; RRID:Addgene_67984) -
For your References section:
A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Tzelepis K, Koike-Yusa H, De Braekeleer E, Li Y, Metzakopian E, Dovey OM, Mupo A, Grinkevich V, Li M, Mazan M, Gozdecka M, Ohnishi S, Cooper J, Patel M, McKerrell T, Chen B, Domingues AF, Gallipoli P, Teichmann S, Ponstingl H, McDermott U, Saez-Rodriguez J, Huntly BJ, Iorio F, Pina C, Vassiliou GS, Yusa K. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. 10.1016/j.celrep.2016.09.079 PubMed 27760321