pRosa26-EF1a-hCas9IRESneo
(Plasmid
#67987)
-
PurposeMouse Rosa26 targeting vector carrying the EF1a-hCas9-IRES-neo cassette
-
Depositing Lab
-
Depositing OrganizationWellcome Sanger Institute
Located in the United Kingdom of Great Britain and Northern Ireland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67987 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 67987-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 67987-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBluescriptII
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 19400
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEF1a-hCas9IRESneopA
-
SpeciesSynthetic
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCTTCCCTCGTGATCTGCAA
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 67987-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 67987-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRosa26-EF1a-hCas9IRESneo was a gift from Kosuke Yusa (Addgene plasmid # 67987 ; http://n2t.net/addgene:67987 ; RRID:Addgene_67987) -
For your References section:
A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Tzelepis K, Koike-Yusa H, De Braekeleer E, Li Y, Metzakopian E, Dovey OM, Mupo A, Grinkevich V, Li M, Mazan M, Gozdecka M, Ohnishi S, Cooper J, Patel M, McKerrell T, Chen B, Domingues AF, Gallipoli P, Teichmann S, Ponstingl H, McDermott U, Saez-Rodriguez J, Huntly BJ, Iorio F, Pina C, Vassiliou GS, Yusa K. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. 10.1016/j.celrep.2016.09.079 PubMed 27760321
Map uploaded by the depositor.
