Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #79873)


Item Catalog # Description Quantity Price (USD)
Plasmid 79873 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 7781
  • Total vector size (bp) 12080
  • Modifications to backbone
    dcas9 was PCR-amplified from pdCas9-bacteria (Addgene #44249) using primers containing BamHI-compatible BsaI sites, digested with BsaI, then ligated into plasmid pAX01 digested with BamHI to generate pJMP1
  • Vector type
    Bacterial Expression, CRISPR
  • Selectable markers
    Bacillus subtilis erythromycin/lincomycin marker

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    catalytically inactive Cas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
  • Mutation
    D10A, H840A
  • Promoter xylA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TCCTTTGTTTATCCACCGAAC
  • 3′ sequencing primer GCCTCGTGATACGCCTATTT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    dcas9 was PCR-amplified from pdCas9-bacteria (Addgene #44249)
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJMP1 was a gift from Carol Gross & Jason Peters & Stanley Qi (Addgene plasmid # 79873 ; ; RRID:Addgene_79873)
  • For your References section:

    A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria. Peters JM, Colavin A, Shi H, Czarny TL, Larson MH, Wong S, Hawkins JS, Lu CH, Koo BM, Marta E, Shiver AL, Whitehead EH, Weissman JS, Brown ED, Qi LS, Huang KC, Gross CA. Cell. 2016 Jun 2;165(6):1493-506. doi: 10.1016/j.cell.2016.05.003. Epub 2016 May 26. 10.1016/j.cell.2016.05.003 PubMed 27238023