-
PurposeBacillus subtilis sgRNA expression vector; integrates into thrC
-
Depositing Labs
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79875 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDG1731
- Backbone size w/o insert (bp) 6673
- Total vector size (bp) 7263
-
Modifications to backboneThe rfp-targeting sgRNA RR1 was PCR-amplified from pgRNA-bacteria (Addgene #44251) using primers containing the veg promoter and EcoRI sites, digested with EcoRI, then ligated into either pDG1662 digested with EcoRI to generate pJMP2.
-
Vector typeBacterial Expression, CRISPR
-
Selectable markersBacillus subtilis spectinomycin marker
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA RR1
-
Alt namesgRNA NT
-
Alt nameanti-RFP sgRNA
-
gRNA/shRNA sequenceAACTTTCAGTTTAGCGGTCT
-
SpeciesStreptococcus pyogenes
- Promoter veg
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer tgtccgttccatctgtgaga
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe rfp-targeting sgRNARR1 was PCR-amplified from pgRNA-bacteria (Addgene #44251) using primers containing the veg promoter and EcoRI sites, digested with EcoRI, then ligated into either pDG1731 digested with EcoRI to generate pJMP3
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that mutation T23S in the BSU homology region was found during Addgene's quality control. The depositor noted that this mutation does NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJMP3 was a gift from Carol Gross & Jason Peters & Stanley Qi (Addgene plasmid # 79875 ; http://n2t.net/addgene:79875 ; RRID:Addgene_79875) -
For your References section:
A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria. Peters JM, Colavin A, Shi H, Czarny TL, Larson MH, Wong S, Hawkins JS, Lu CH, Koo BM, Marta E, Shiver AL, Whitehead EH, Weissman JS, Brown ED, Qi LS, Huang KC, Gross CA. Cell. 2016 Jun 2;165(6):1493-506. doi: 10.1016/j.cell.2016.05.003. Epub 2016 May 26. 10.1016/j.cell.2016.05.003 PubMed 27238023