5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
(Plasmid #68357)

• Purpose: The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.
• Depositing Lab: Jannik Elverløv-Jakobsen
• Depositing Organization: Aarhus University
  Located in Denmark
• Publication: Cas9/CRISPR pig transposon plasmid_LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR (unpublished)

Backbone

• Vector backbone: Amp
• Backbone size w/o insert (bp): 2500
• Total vector size (bp): 8356
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: 5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
• gRNA/shRNA sequence: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
• Species: Synthetic
• Insert Size (bp): 1059
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NruI (unknown if destroyed)
• 3′ cloning site: SpeI (unknown if destroyed)
• 5′ sequencing primer: ttttggcaagtcagttaggaca
• 3′ sequencing primer: GGAATGGTAGATGTTTAAAC

Gene/Insert 2

• Gene/Insert name: FlpO recombinase
• gRNA/shRNA sequence: -----
• Species: Synthetic
• Insert Size (bp): 1300
• Promoter: synthetic Probasin ARRx2
• Tag / Fusion Protein:
  • mTurquoise2 (BFP) (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (unknown if destroyed)
• 3′ cloning site: PacI (unknown if destroyed)
• 5′ sequencing primer: GGAATGGTAGATGTTTAAAC
• 3′ sequencing primer: aagtcgtgctgcttcatgtg

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 68357-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 68357-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.